Research Report
Genetic Diversity of African Mistletoe (Loranthus micranthus Linn.) Accessions from Selected Plant Hosts Using Internal Transcribed Spacer (ITS) Gene 
Author
Correspondence author
International Journal of Molecular Evolution and Biodiversity, 2019, Vol. 9, No. 2 doi: 10.5376/ijmeb.2019.09.0002
Received: 01 Jul., 2019 Accepted: 18 Aug., 2019 Published: 17 Sep., 2019
Osuagwu A.N., Oparaugo V.C., and Ekerette E.E., 2019, Genetic diversity of African mistletoe (Loranthus micranthus Linn.) accessions from selected plant hosts using Internal Transcribed Spacer (ITS) gene, International Journal of Molecular Evolution and Biodiversity, 9(2): 9-15 (doi: 10.5376/ijmeb.2019.09.0002)
African mistletoe (Loranthus micranthus Linn.) is a parasitic plant which has shown to contain biologically active agents that have disease curing effects on humans. The present study aimed at evaluating the genetic diversity of L. micranthus accessions established on selected plant host based on ITS gene. 9 samples were selected for PCR amplification and sequencing of the its1 and its4 regions. The results revealed 104 and 89 polymorphic sites for its1 and its4 respectively. Haplotype diversity of 0.971+0.064 and nucleotide diversity 0.174+0.071 were recorded in its1 while haplotype diversity of 0.917+0.092 and nucleotide diversity of 0.231+0.027 were recorded in its4. Phylogenetic analysis grouped the samples into 2 clusters based on the its regions. A high genetic distance (0.597) for its1 was obtained between samples from Pepper fruit and samples obtained from other host trees (African apple, Avocado and Monkey kola) while a low genetic distance (0.000) was obtained between C. apiculatum (LMV9) and African apple host (LMV4). The highest genetic distance (0.827) for its4 was obtained between C. apiculatum (LMV9) and African apple host (LMV4) while the lowest genetic distance (0.000) was obtained between Rubber hosts (LMV1, LMV2) and Pepper fruit host (LMV8). The results revealed some genetic diversity amongst the mistletoe grown on different hosts suggesting that host trees and geographical location might contribute to genetic diversity. It also showed that its1 and 4 regions differ in their variation discernment pattern in mistletoe and similar studies can be conducted in larger populations to accurately link genetic similarity/variation to host specificity and geographical origins.
Introduction
Loranthus micranthus L. is a parasitic plant that belongs to the family Loranthaceae and Order Santalales. Most genera of African mistletoes belong to the family Loranthaceae (Polhill and Wiens, 1998). Mistletoe plants are found growing on a wide range of host trees and the leaves have been used for pharmaceutical purposes (Kernezehok et al., 1997). The composition and activities of mistletoe as well as its efficiency in the treatment of various diseases are said to be dependent on host-tree and harvesting period (Obatomi et al., 1994; Osadebe et al., 2004).
The mistletoe plant has been used in ethno medication as treatment for hypertension, diabetes, schizophrenia and as an immune booster in Nigeria and some parts of Africa (Osadebe et al., 2004; Osadebe and Omeje, 2009). The ethnomedicinal use of the plant has also been extended to the treatment of other diverse human and animal ailments including dysentery, diarrhea, stomach ache, wound, chronic fever, rheumatism, internal worm infections, asthma, inflammations, dyspepsia, dermatitis, bronchitis, cough, constipation and cancer (Spencer, 2008; Ndamitso et al., 2013).
Despite the wide use of mistletoe plants for medicinal purposes amongst local dwellers, the use of mistletoe cannot be routinely recommended as documentation on its molecular profile is limited. The possible benefits from the use of mistletoe for tradomedicinal purposes are limited by lack of scientific basis, warranting that its quality and consistency as alternative medicine be ascertained and maintained for their maximal use and efficacy.
The its regions of rDNA have proven to be of specific usefulness for diversity studies due to the fact that the rate of accumulation of mutation in these regions often approximates to the rate of speciation (Lee and Taylor, 1992). A good insight into the pattern of variation as well as the relationship between the accessions is a prerequisite for making conservation and sustainability plans. Analysis of its regions of rDNA in plants has revealed its usefulness for diversity and phylogeny studies because it is reported that the rate of accumulation of mutation in these regions approximates to the rate of speciation (Lee and Taylor, 1992). A good insight into the variation existing in the mistletoe plants in relation to its hosts and geographical dispersions will provide an informed scientific basis for its efficacious usage for tradomedicinal purposes, thus bridging the gap between scientific knowledge and traditional (alternative) medicine for the good of humanity.
The aim of this study was to evaluate the genetic diversity of African mistletoe (Loranthus micranthus L.) accessions established on various plant hosts using the internal transcribed spacer region (ITS) in order to establish the veracity or otherwise, the notion that the potency of mistletoe as a drug is host dependent.
1 Materials and Methods
1.1 Collection of leaf samples
Leaf samples were harvested from nine (9) tree hosts in different locations in Cross River state (Table 1). The samples were washed separately in water and air dried for two weeks at room temperature. The dried leaf samples were packaged in ziplock bags with silica gel beads and transported to the lab for DNA extraction and analysis.
Table 1 Codes and host origin of samples from nine accessions of L. micranthus |
1.2 DNA extraction and PCR amplification
Powdered L. micranthus leave samples (200mg each) were transferred to collection tubes. DNA extraction was performed according to NucleoSpin Plantn II-Fungi manufacturer’s instructions (Macherey-Nagel, Duren, Germany). The concentrations of DNA samples were measured using the NanoDrop Lite ND-1000 spectrophotometer (Thermo Fisher Scientific). PCR amplification was performed for its1(F) CTTGGTCATTTAGAGGAAGTAA and its4(R) TCCTCCGCTTATTGATATGC regions. All amplification reactions were performed in a 25 μL reaction volume. PCR conditions were an initial denaturation stage of 95℃ for 3 min, a second stage of 27 cycles of denaturation at 98℃ for 20 sec, annealing at 58℃ for 30 sec and extension at 72℃ for 60 sec, and a final extension stage at 72℃ for 4 min. The quality of DNA was determined by electrophoresis on a 2 percent agarose gel that was stained with GelRed (Thermo Fisher Scientific, Massachusetts, USA) nucleic acid stain. The gels were run for ≈60 min with constant voltage (100 V) prior to imaging under UV light “G: Box Gel Documentation System” (Syngene, Maryland, USA). PCR products were purified using the Zymo DNA Clean & Concentrator Kit (Zymo Research, California, USA).
1.3 Gene sequencing
PCR was carried out in a total volume of 10 µl with annealing temperature specific to 50℃. The cycling sequencing reactions were prepared for each template with the BigDye Terminator v3.1 kit (Applied Biosystems). Reactions included 1x BigDye Terminator Premix, 3.2 µM of sequencing primer (either forward or reverse gene-specific PCR primer), 1x Sequencing buffer, and 2 ng purified PCR amplification. The conditions for PCR was an initial denaturation at 96℃ for 1 minute, followed by 25 cycles of 96℃ for 10 seconds, 50℃ for 5 seconds, and 60℃ for 4 min. Cycle sequencing products were purified using DNA Sequencing Clean-Up Kit (Zymo Research, California, USA). The purified sequencing products were analysed using Sanger Sequencing on an ABI 3500 Genetic Analyser (Applied Biosystems, California, USA).
1.4 Statistical analysis
Bioedit software version 7.2.5 (Hall, 1999) was used to view and edit the sequences. MEGA 6.06 was used for multiple sequence alignment of all the samples (Tamura et al., 2013) excluding all the gaps. Estimation of polymorphism in the aligned regions including nucleotide diversity and haplotype diversity (Hd) values was carried out using DnaSP 5.1 software (Librado and Rozas, 2009). Phylogenetic analysis of samples from the populations was constructed using MEGA 6.06 (Tamura et al., 2013). The genetic distance between leaf samples were performed using MEGA 6.06 (Tamura et al., 2013). NETWORK 4.6.1.1 was used for network analysis of the different haplotypes (Bandelt et al., 1999).
2 Results and Discussion
2.1 DNA concentration
DNA obtained from LMV3 (mistletoe found on African apple tree in Akpabuyo) had the highest concentration at 867.6 ng/µl while LMV1 (rubber host) had the least concentration with 163.8 ng/µl. Pure DNA preparations have an A260/A280 ratio of ≥1.8. LMV4 had the highest A260/A280 ratio of 1.98 while the least was LMV3 at 1.71 (Table 2).
Table 2 DNA concentration in leaf samples from nine accessions of L. micranthus |
2.2 Genetic diversity
There were 8 haplotypes in its1 genes with haplotype diversity of 0.972±0.064 and nucleotide diversity of 0.174±0.071. In its4 gene, 7 haplotypes were identified with 0.917±0.092 haplotype diversity and 0.231±0.027 nucleotide diversity. Sequence conservation was recorded as 56.5% and 29.3% in its1 and its4, respectively (Table 3).
Table 3 Genetic diversity indices of its1 and its4 genes from nine accessions of L. micranthus |
2.3 Genetic distance
The highest genetic distances were observed between its1 of mistletoe plant obtained from Pepper fruit (ITS1_LMV8) and all the samples sequenced for its1 gene while the highest genetic distance for its4 gene was recorded between ITS4_LMV9 and ITS4_LMV4. Genetic distance within its1 and its4 gene for the sequences of the 9 mistletoe plants is presented (Table 4 and Table 5).
Table 4 Genetic distance of its1 gene in nine accessions of L. micranthus |
Table 5 Genetic distance of its4 gene from nine accessions of L. micranthus |
2.4 Haplotype frequency
8 and 7 haplotypes were identified in its1 and its4 respectively (Table 6 and Table 7). Samples from African apple and C. apiculatum hosts (ITS1_LMV4 and ITS1_LMV9) shared the same haplotype while samples from Rubber tree hosts (ITS4_LMV1, ITS4_LMV2) and Pepper fruit host (ITS4_LMV8) shared the same haplotype.
Table 6 Haplotype distribution in its1 gene from nine accessions of L. micranthus |
Table 7 Haplotype distribution in its4 gene from nine accessions of L. micranthus |
2.5 Phylogenetic analysis
A dendrogram was constructed to analyse the genetic diversity among the 9 accessions. The plants were grouped based on the two genes (Figure 1). There were two major clusters obtained from the analysis with 100 and 94 bootstrap values for cluster I and II, respectively. Cluster I had two sub-clusters where ITS1_LMV8 was seen within a single clade. On the other hand, ITS1_LMV1 to ITS1_LMV7 and ITS1_LMV9 were all grouped under the same sub-cluster with 99 bootstrap value. There were also two sub-clusters under cluster II where ITS4_LMV9 separated into a single clade and ITS4_LMV1 to ITS4_LMV8 were under the same sub-cluster with 94 bootstrap value.
Figure 1 Relationships between accessions of L. micranthus based on its1 and its4 genes |
2 Discussion
A good understanding of the patterns of variation among species is of maximum importance in making conservation and sustainability plans. Assessing the molecular profile of mistletoe leaves is imperative in order to expose new frontiers for the improvement of its current applications.
High quality, intact pure DNA is required for accurate analysis in molecular genetics. The results from the DNA extraction revealed that the highest quantity of DNA was obtained from LMV3 (African apple I, from Akpabuyo) while the purest sample was from LMV4 (African apple II, from Unical Staff quarters). The variation in quantity of DNA harvested could be as a result of the size and age of leaf samples selected. DNA per chloroplast has shown to decrease for older and larger leaf samples as DNA initially increases then decreases during leaf development and maturity (Shaver et al., 2006; Rowan and Bendich, 2009).
The results for genetic variation including nucleotide and haplotype diversity for both its regions showed that there were 104 and 89 polymorphic sites for its1 and its4 respectively, resulting in haplotype diversity of 0.972±0.064 and 0.917±0.092 and nucleotide diversity of 0.174±0.071 and 0.231±0.027 for its1 and its4 regions, respectively. This was in line with the findings of Zhang et al., (2018) where a haplotype and nucleotide diversity of 0.86 and 0.0087 was reported in 199 accessions of Melilotus species.
The number of recombination processes which was higher in the its4 region may not have had significant contribution to polymorphism as its4 had lower polymorphic sites when compared with the its1 region which had higher polymorphic sites with lower recombination processes. The expectation should be that higher recombination processes should result in higher polymorphism. Hence, it is likely that the recombination processes resulted in synonymous mutations.
Genetic distances measure genetic differences between species. Species with similar alleles have lower genetic distances as an indication of their genetic similarity (Nei, 1987). Across the 9 samples studied, the highest genetic distances for its1 region were observed between mistletoe from Pepper fruit and samples from other host trees while the lowest genetic distances were observed between mistletoe from LMV9 and LMV4. The highest genetic distances for its4 were observed between LMV9 and LMV4 while the lowest genetic distances were observed in LMV1 and LMV2 as well as LMV8. The haplotype diversity studies for its1 revealed that samples from LMV9 and LMV4 were genetically similar as they shared haplotype 4. From the cluster analysis, samples from LMV9 and LMV4 were also placed in the same sub-sub cluster. A likely reason for close genetic distance between both samples could be as a result of their being obtained from same location in spite of differences in hosts thus indicating they may have a common ancestry. Phytochemical analyses would tell if the similarity of gene sequence can translate to similarity in quality and quantities of the phytochemicals.
Haplotype diversity studies in its4 region suggested that both samples from Rubber and Pepper fruit shared common ancestry as they both share haplotype 1. This was further expressed by the dendrogram where they were placed in the same sub-sub cluster. It is pertinent to note here that not all samples from the same location and tree host were clustered together. That is, although samples from African apple I and II were placed in same sub cluster, they did not share sub-sub cluster. Existence in same cluster might be as their being from same host plant while placement in sub-sub cluster could further be as a result of being from separate geographical origin. Hence this indicates that geographical origin might have a greater/higher impact on diversity than host trees. Also, samples from Rubber trees were clustered together for both its regions and belonged to same haplotype group. This could further suggest that mistletoe grown on same host and more importantly found in same region are genetically similar.
3 Conclusion
The results from this study revealed high genetic diversity among L. micranthus grown on different hosts. It also suggests that host trees and geographical location might contribute to genetic similarities. From the various genetic analysis conducted in this work, it can be emphatically stated that its1 and its4 regions differ in their pattern of estimating genetic diversity.
References
Bandelt H.J., Forster P., and Rohl A., 1999, Median-joining networks for inferring intraspecific phylogenies, Molecular Biology and Evolution, 16(1): 37-48
https://doi.org/10.1093/oxfordjournals.molbev.a026036
Hall T.A., 1999, Bioedit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT, Nucleic Acid Symposium Series, 41: 95-98
Kernzehok E.P., Jacobsen T.D. & Aronis J., 1997, American mistletoe exposures, American Journal of Emergency Medicine, 15: 516-520
https://doi.org/10.1016/S0735-6757(97)90199-6
Lee S.B and Taylor J.W., 1992, Phylogeny of five fungus-like protoctistan phytophthora species, inferred from the internal transcribed spacers of ribosomal DNA, Journal of Molecular Evolution, 9: 636-653
Librado P. and Rozas J., 2009, DnaSP version 5: a software for comprehensive analysis of DNA polymorphism data, Bioinformatics, 25: 1441-1452
https://doi.org/10.1093/bioinformatics/btp187
Ndamitso M.M., Musah M., Mohammed-Hadi Z., Idris S., Tijani O.J., Shaba E.Y. & Umar A., 2013, Analysis of phytochemical content and antibacterial activity of Tapinanthus dodoneifolius extract, Researcher, 5(5): 54-59
Nei M., 1987, Molecular evolutionary genetics, New York: Columbia University Press
https://doi.org/10.7312/nei-92038
Obatomi D.K., Bikomo E.O., and Temple V.J., 1994, Anti-diabetic properties of the African mistletoe in streptozotocin-induced diabetic rats, Journal of Ethnopharmacology, 43(1): 13-17
https://doi.org/10.1016/0378-8741(94)90111-2
Osadebe P.O., and Omeje E.O., 2009, Comparative acute toxicities and immunomodulatory potentials of five Eastern Nigeria Mistletoes, Journal of Ethnopharmacology, 126(2): 287-293
https://doi.org/10.1016/j.jep.2009.08.024
Osadebe P.O., Okide G.B., and Akabogu I.C., 2004, Study on anti-diabetic activities of crude methanolic extracts of Loranthus micranthus (Linn) sourced from five different host trees, Journal of Ethnopharmacology, 95: 133-138
https://doi.org/10.1016/j.jep.2004.06.029
Polhill R., and Wiens D., 1998, Mistletoes of Africa, The Royal Botanic Garden, Kew, UK, 370
Rowan B.A., and Bendich A.J., 2009, The loss of DNA from chloroplasts as leaves mature: fact or artefact, Journal of Botany, 60(11): 3005-3010
https://doi.org/10.1093/jxb/erp158
Shaver J.M., Oldenburg D.J., and Bendich A.J., 2006, Changes in chloroplast DNA during development in tobacco, Medicago truncatula, pea and maize, Planta, 224: 72-82
https://doi.org/10.1007/s00425-005-0195-7
Spencer J.P.E., 2008, Flavonoid modulators of brain function, The British Journal of Nutrition, 99: 143-151
https://doi.org/10.1017/S0007114508965776
Tamura K., Stecher G., Peterson D., Filipski A. and Kumar S., 2013, MEGA6: molecular evolutionary genetics analysis version 6.0, Molecular Biology and Evolution, 30: 2725-2729
https://doi.org/10.1093/molbev/mst197
Zhang H., Wu F., Guo W., Bai R., Yan Z., Muvunyi B.P., Yan Q., Zhang Y., Yi X. & Zhang J., 2018, Genetic variation and diversity in 199 Melilotus accessions based on a combination of DNA sequences, PloS ONE, 13(3)
. PDF(494KB)
. HTML
Associated material
. Readers' comments
Other articles by authors
. A.N. Osuagwu
. V. C. Oparaugo
. E. E. Ekerette
Related articles
. Its gene
. Loranthus micranthus
. Genetic diversity
. Phylogeny
. Polymorphic sites
Tools
. Email to a friend
. Post a comment
.png)
.png)
.png)
.png)
.png)
.png)
.png)
.png)